| Detail of EST/Unigene GE345720 |
| Acc. | GE345720 |
| Internal Acc. | MEUAR39TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Monothiol glutaredoxin-S7, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-33; Monothiol glutaredoxin-S14, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; Uncharacterized monothiol glutaredoxin ycf64-like OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-18; Glutaredoxin-related protein 5, mitochondrial OS=Homo sapiens E-value=2e-16; Glutaredoxin-related protein 5, mitochondrial OS=Mus musculus E-value=2e-16; |
| Length | 551 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGAATTGGAGTTGAACTCAGAAACTGAACAAACAATCATGTCTTTCAGTTCGTGCGTTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824655 |
| Trichome-related Gene from Literature | N/A |