| Detail of EST/Unigene GE345732 |
| Acc. | GE345732 |
| Internal Acc. | MEUAR52TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=1e-42; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=8e-38; Cytochrome P450 734A2 OS=Oryza sativa subsp. japonica E-value=6e-35; Cytochrome P450 734A4 OS=Oryza sativa subsp. japonica E-value=2e-34; Secologanin synthase OS=Catharanthus roseus E-value=9e-34; |
| Length | 791 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | ATTTGATCAAGGAAGTGTTGGTTACTAATTGTGTTGAGTATGGGAAGGTTCCTTACAATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
| EC | 1.14.14.1 1.14.15.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843850 |
| Trichome-related Gene from Literature | N/A |