Detail of EST/Unigene GE345829 |
Acc. | GE345829 |
Internal Acc. | MEUAS67TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=5e-40; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=2e-38; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=5e-12; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=5e-12; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=7e-12; |
Length | 374 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAGATAAAGTTATTGCTAAACTCACAAATGAATATGGAGGTGGACTAGCTGAGTTTGCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826914 |
Trichome-related Gene from Literature | N/A |