Detail of EST/Unigene GE345932 |
Acc. | GE345932 |
Internal Acc. | MEUAT84TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase CTR1 OS=Arabidopsis thaliana E-value=0; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=3e-49; Probable serine/threonine-protein kinase drkD OS=Dictyostelium discoideum E-value=5e-49; Probable serine/threonine-protein kinase DDB_G0271682 OS=Dictyostelium discoideum E-value=6e-48; Probable serine/threonine-protein kinase drkA OS=Dictyostelium discoideum E-value=2e-46; |
Length | 717 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GATCGAGGGTAGGAGGTTTATTGAAGGAAGTCAACTAATTCCTAGCAAGCCTACTCGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04424 sterile alpha motif and leucine zipper containing kinase AZK |
EC | 2.7.11.1 2.7.11.25 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 831748 |
Trichome-related Gene from Literature | 831748 |