Detail of EST/Unigene GE346036 |
Acc. | GE346036 |
Internal Acc. | MEUAV03TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=2e-70; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=5e-69; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=5e-69; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-67; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-67; |
Length | 675 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGATCAACATCTAGGTTTGTACTCATCTCACAACTAGCTATATTATTCCCCTTATTTTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |