| Detail of EST/Unigene GE346063 |
| Acc. | GE346063 |
| Internal Acc. | MEUAV34TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=6e-38; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=1e-37; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=6e-29; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-23; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=4e-23; |
| Length | 773 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | TGGACCCCATGCTGTGGAAAAGAAAGAAAAAACAGCAAACCATTCTCATGAAAATTGTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.1.52 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822281 |
| Trichome-related Gene from Literature | N/A |