Detail of EST/Unigene GE346336 |
Acc. | GE346336 |
Internal Acc. | MEUAX28TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=2e-93; Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=9e-93; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=5e-91; Glutamine synthetase, chloroplastic OS=Brassica napus E-value=7e-87; Glutamine synthetase, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-86; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGTTGGTCCTAGCGTAGGTATTGAAGCTGGTGATCATATCTGGGCTTCAAGGTACATCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |