| Detail of EST/Unigene GE346398 |
| Acc. | GE346398 |
| Internal Acc. | MEUAX65TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Pisum sativum E-value=1e-21; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; ATP synthase gamma chain, chloroplastic OS=Spinacia oleracea E-value=6e-19; ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=1e-18; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=7e-17; |
| Length | 161 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GAAAAAAGTTGCTCTTGTTGTTTGCACTGGTGATAGAGGTCTCTGTGGTGGATTCAACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 825797 |
| Trichome-related Gene from Literature | N/A |