Detail of EST/Unigene GE346522 |
Acc. | GE346522 |
Internal Acc. | MEUAY37TFB |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydroflavonol-4-reductase OS=Petunia hybrida E-value=3e-27; Dihydroflavonol-4-reductase OS=Solanum lycopersicum E-value=1e-26; Dihydroflavonol-4-reductase OS=Gerbera hybrida E-value=1e-25; Dihydroflavonol-4-reductase OS=Callistephus chinensis E-value=2e-25; Anthocyanidin reductase OS=Arabidopsis thaliana E-value=4e-25; |
Length | 561 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGAAGTTAGAGTATCATCAGTGATGATGGAAAGGAGGTGCAAGGTGTGTGTTACAGGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.170 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842469 |
Trichome-related Gene from Literature | 842469 |