Detail of EST/Unigene GE346537 |
Acc. | GE346537 |
Internal Acc. | MEUAY45TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; Thioredoxin M2, chloroplastic OS=Arabidopsis thaliana E-value=9e-15; Thioredoxin M1, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-14; Thioredoxin M-type, chloroplastic OS=Brassica napus E-value=2e-13; Thioredoxin M1, chloroplastic OS=Arabidopsis thaliana E-value=2e-13; |
Length | 310 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | ACCGTACAACTCGAATCCTTCTCCCTTATTCGCTCTCCTATCGTCGCTTCTTCTCGCCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.3.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |