Detail of EST/Unigene GE346714 |
Acc. | GE346714 |
Internal Acc. | MEUAZ49TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Single-stranded DNA-binding protein, mitochondrial OS=Arabidopsis thaliana E-value=4e-58; Single-stranded DNA-binding protein OS=Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp) E-value=7e-10; Single-stranded DNA-binding protein OS=Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB 8253 / DSM 158) E-value=7e-09; Single-stranded DNA-binding protein OS=Wigglesworthia glossinidia brevipalpis E-value=1e-08; Single-stranded DNA-binding protein OS=Shigella flexneri E-value=2e-08; |
Length | 579 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGTTGCAGTTCCTCGTTTGCTGGAAATGAATTCTGTTGCGCTAAGACTTTCCAAGCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K03111 single-strand DNA-binding protein; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K03111 single-strand DNA-binding protein; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K03111 single-strand DNA-binding protein |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826707 |
Trichome-related Gene from Literature | N/A |