Detail of EST/Unigene GE346904 |
Acc. | GE346904 |
Internal Acc. | MEUB127TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Fructan 6-exohydrolase OS=Beta vulgaris E-value=2e-40; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=7e-34; Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=7e-34; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=7e-32; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=8e-30; |
Length | 415 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | TTTGTGTAGTCAAAAGGGTGCATCAGTAAAAGGTGGTGTTGGACCATTTGGTCTGCATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |