Detail of EST/Unigene GE346989 |
Acc. | GE346989 |
Internal Acc. | MEUB221TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative transferase CAF17 homolog, mitochondrial OS=Mus musculus E-value=1e-23; Putative transferase CAF17 homolog, mitochondrial OS=Danio rerio E-value=7e-23; Putative transferase CAF17, mitochondrial OS=Homo sapiens E-value=2e-22; Putative transferase CAF17, mitochondrial OS=Ustilago maydis (strain 521 / FGSC 9021) E-value=6e-14; Putative transferase CAF17, mitochondrial OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) E-value=7e-12; |
Length | 670 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAACCGAGATTCCAAAAGGTGAAGCAATGCCACTTGAGTATAATTTTGTAGGCCTTAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826821 |
Trichome-related Gene from Literature | N/A |