Detail of EST/Unigene GE347164
Acc. GE347164
Internal Acc. MEUB415TF
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 40S ribosomal protein S29 OS=Arabidopsis thaliana E-value=7e-12; 40S ribosomal protein S29 OS=Triticum aestivum E-value=4e-11; 40S ribosomal protein S29 OS=Ixodes scapularis E-value=1e-08; 40S ribosomal protein S29 OS=Griffithsia japonica E-value=2e-08; 40S ribosomal protein S29 OS=Spodoptera frugiperda E-value=1e-07;
Length 110 nt
Species Medicago truncatula
Belonged EST Libraries MT_JCVI-MT2;
Sequence AAGAAATCGAAGACAGCCATGGGTCACTCCAACGTTTGGAACTCTCACCCAAAGACCTAT
GGTCCTGGTTCTCGTACCTGCCGTGTGTGTGGAAACTCTCATGGATTGAT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02980 small subunit ribosomal protein S29e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 829529 
Trichome-related Gene from Literature N/A