Detail of EST/Unigene GE347227 |
Acc. | GE347227 |
Internal Acc. | MEUB486TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=3e-53; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=2e-51; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-48; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=8e-47; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=8e-45; |
Length | 723 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGAAGTGCTGAAAAACCTGACTGCACTTTCCACAAACTATTGAGTAGAAGAATTTTACAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |