Detail of EST/Unigene GE347388 |
Acc. | GE347388 |
Internal Acc. | MEUB672TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 11 OS=Arabidopsis thaliana E-value=9e-20; SKP1-like protein 12 OS=Arabidopsis thaliana E-value=1e-19; SKP1-like protein 14 OS=Arabidopsis thaliana E-value=7e-19; SKP1-like protein 9 OS=Arabidopsis thaliana E-value=2e-17; SKP1-like protein 18 OS=Arabidopsis thaliana E-value=3e-16; |
Length | 637 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGAAAGTAACTTTTACCTTTACCTTTCACTTTTCACCCCCAAACCCTAGTTGAACACGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829569 |
Trichome-related Gene from Literature | N/A |