Detail of EST/Unigene GE347536 |
Acc. | GE347536 |
Internal Acc. | MEUB837TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 OS=Nicotiana tabacum E-value=8e-58; Cytochrome b5, seed isoform OS=Nicotiana tabacum E-value=3e-57; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=5e-57; Cytochrome b5 OS=Oryza sativa subsp. japonica E-value=2e-53; Cytochrome b5 OS=Borago officinalis E-value=2e-53; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAACTACTGATCAATCAACAATGGGTGAAGAGCGTAAGGTGTTCACTTTGGCTGATGTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- 1.6.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |