Detail of EST/Unigene GE347555 |
Acc. | GE347555 |
Internal Acc. | MEUB857TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=2e-58; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=4e-58; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=1e-47; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=4e-44; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=2e-31; |
Length | 610 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGAAATAAAGATATGGTTTGTTTGGTATCTCGCTCTGGAAGGGAGTTGCAGAGATATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 814696 |
Trichome-related Gene from Literature | N/A |