Detail of EST/Unigene GE347557 |
Acc. | GE347557 |
Internal Acc. | MEUB859TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pleckstrin homology domain-containing protein 1 OS=Arabidopsis thaliana E-value=1e-55; PH domain-containing protein DDB_G0274775 OS=Dictyostelium discoideum E-value=6e-11; Pleckstrin homology domain-containing family H member 1 OS=Homo sapiens E-value=4e-10; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=8e-10; Pleckstrin homology domain-containing family H member 1 OS=Danio rerio E-value=2e-09; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGAAGATTTAAGAACTCACTTCACACAAACACTTGTTTCTAGAGAGAGAAGGATGGAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04456 RAC serine/threonine-protein kinase |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817520 |
Trichome-related Gene from Literature | N/A |