Detail of EST/Unigene GE347603 |
Acc. | GE347603 |
Internal Acc. | MEUB916TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S19, mitochondrial OS=Petunia hybrida E-value=2e-25; 40S ribosomal protein S19, mitochondrial OS=Arabidopsis thaliana E-value=3e-22; Ribosomal protein S19, mitochondrial OS=Marchantia polymorpha E-value=9e-13; Ribosomal protein S19, mitochondrial OS=Prototheca wickerhamii E-value=5e-11; Ribosomal protein S19, mitochondrial OS=Platymonas subcordiformis E-value=5e-11; |
Length | 604 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGAACTAACTCCCGGAAATCGCCGTCGGAGTTTCCCAGTCGCCGCCACTAACGGTGACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834779 |
Trichome-related Gene from Literature | N/A |