| Detail of EST/Unigene GE347628 |
| Acc. | GE347628 |
| Internal Acc. | MEUB943TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Proteasome subunit alpha type-5 OS=Glycine max E-value=2e-10; Proteasome subunit alpha type-5 OS=Oryza sativa subsp. japonica E-value=5e-10; Proteasome subunit alpha type-5-B OS=Arabidopsis thaliana E-value=5e-10; Proteasome subunit alpha type-5-A OS=Arabidopsis thaliana E-value=5e-10; Probable proteasome subunit alpha type-5 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-08; |
| Length | 100 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | ACGTTTGTTTCAGGTTGAATATGCAATTGAAGCCATTAAGCTTGGATCAACTGCGATTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K02729 20S proteasome subunit alpha 5 |
| EC | 3.4.25.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820649 |
| Trichome-related Gene from Literature | 820649 |