| Detail of EST/Unigene GE347693 |
| Acc. | GE347693 |
| Internal Acc. | MEUBA14TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Brachyspira hyodysenteriae (strain ATCC 49526 / WA1) E-value=1e-43; GMP synthase [glutamine-hydrolyzing] OS=Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM) E-value=9e-43; GMP synthase [glutamine-hydrolyzing] OS=Macrococcus caseolyticus (strain JCSC5402) E-value=4e-42; GMP synthase [glutamine-hydrolyzing] OS=Vibrio vulnificus (strain YJ016) E-value=5e-42; GMP synthase [glutamine-hydrolyzing] OS=Vibrio vulnificus (strain CMCP6) E-value=6e-42; |
| Length | 731 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGGCATTTGCATAAACCCTACTGAGTGGAGTTGGTTCTACTAGCAAGAGAGTACAGCAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
| EC | 6.3.5.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842670 |
| Trichome-related Gene from Literature | N/A |