Detail of EST/Unigene GE348360 |
Acc. | GE348360 |
Internal Acc. | MEUBH56TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=4e-18; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-14; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-13; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=2e-13; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-12; |
Length | 584 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAATAGTATAGCAGTACTAACATTAGTACAACGTTGCAGACAAGGCATCATAACCATGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844188 |
Trichome-related Gene from Literature | N/A |