Detail of EST/Unigene GE348387 |
Acc. | GE348387 |
Internal Acc. | MEUBH84TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=6e-68; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=1e-67; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=1e-66; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=2e-66; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=3e-66; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGAACACAACACAACATGTTATCACTTTGTTCTTCCTCATCCATGGCTAAGGCTTCCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 1.11.1.7 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |