| Detail of EST/Unigene GE348399 |
| Acc. | GE348399 |
| Internal Acc. | MEUBI03TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Violaxanthin de-epoxidase, chloroplastic OS=Lactuca sativa E-value=2e-39; Violaxanthin de-epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-38; Violaxanthin de-epoxidase, chloroplastic OS=Spinacia oleracea E-value=6e-37; Violaxanthin de-epoxidase, chloroplastic OS=Nicotiana tabacum E-value=5e-36; |
| Length | 710 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GGGGTGGCAGTGTGTTTGCAGTCCACATACACCATGCTCTTATTCTTATCTAATCTTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837377 |
| Trichome-related Gene from Literature | N/A |