Detail of EST/Unigene GE348399 |
Acc. | GE348399 |
Internal Acc. | MEUBI03TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Violaxanthin de-epoxidase, chloroplastic OS=Lactuca sativa E-value=2e-39; Violaxanthin de-epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-38; Violaxanthin de-epoxidase, chloroplastic OS=Spinacia oleracea E-value=6e-37; Violaxanthin de-epoxidase, chloroplastic OS=Nicotiana tabacum E-value=5e-36; |
Length | 710 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGGGTGGCAGTGTGTTTGCAGTCCACATACACCATGCTCTTATTCTTATCTAATCTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837377 |
Trichome-related Gene from Literature | N/A |