Detail of EST/Unigene GE348602 |
Acc. | GE348602 |
Internal Acc. | MEUA037TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=0; |
Length | 765 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AAACACATATGTAGTATTATTGAAAATTAATCTCTGAAATACACGATCAAGGACATTTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824287 |
Trichome-related Gene from Literature | 824287 |