| Detail of EST/Unigene GE348611 |
| Acc. | GE348611 |
| Internal Acc. | MEUA052TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=6e-34; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=2e-33; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=2e-33; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=8e-33; Beta-glucosidase 16 OS=Arabidopsis thaliana E-value=7e-30; |
| Length | 614 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | ACTCCCTTGCCTTTTCTTCAAGTTGAGACCAATCAACATAAGAACATTTAGTGTACCGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825183 |
| Trichome-related Gene from Literature | N/A |