Detail of EST/Unigene GE348632 |
Acc. | GE348632 |
Internal Acc. | MEUA085TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Formimidoyltransferase-cyclodeaminase OS=Rattus norvegicus E-value=1e-06; Formimidoyltransferase-cyclodeaminase OS=Mus musculus E-value=1e-06; |
Length | 795 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GATCCGCAAAAGCTAATACTCCATTTTCAAAGTTAGATGTTACACACAACAATTTTCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K01746 formiminotetrahydrofolate cyclodeaminase |
EC | 2.1.2.5 4.3.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816615 |
Trichome-related Gene from Literature | N/A |