Detail of EST/Unigene GE348635 |
Acc. | GE348635 |
Internal Acc. | MEUA088TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-50; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=3e-45; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=3e-44; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-44; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=3e-43; |
Length | 564 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CAATGGGTTGAATCCATATATTGAAAGATAATCCTTACACAGATATGATAAAGATACAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |