Detail of EST/Unigene GE348719
Acc. GE348719
Internal Acc. MEUA216TR
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 60S ribosomal protein L13a OS=Lupinus luteus E-value=3e-09; 60S ribosomal protein L13a-4 OS=Arabidopsis thaliana E-value=3e-09; 60S ribosomal protein L13a-3 OS=Arabidopsis thaliana E-value=7e-09; 60S ribosomal protein L13a-2 OS=Arabidopsis thaliana E-value=7e-09; 60S ribosomal protein L13a-1 OS=Arabidopsis thaliana E-value=4e-08;
Length 90 nt
Species Medicago truncatula
Belonged EST Libraries MT_JCVI-MT2;
Sequence CCCTCATAGACCTTCAATCGCGCGAGTGCAGCCTCTCCACGCTTAGTTTTATGTGGTATC
ATTCCACGAACAGTGCGCCAAAAGATCTTA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02872 large subunit ribosomal protein L13Ae
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 834934 
Trichome-related Gene from Literature N/A