Detail of EST/Unigene GE348998 |
Acc. | GE348998 |
Internal Acc. | MEUA606TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=4e-37; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=4e-33; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-31; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=9e-23; |
Length | 669 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CCACATAGCTTATATCTTATTAGATACATTACCAAAGAATGATTGAATAAAAGAATGAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838410 |
Trichome-related Gene from Literature | N/A |