| Detail of EST/Unigene GE349198 |
| Acc. | GE349198 |
| Internal Acc. | MEUA870TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=1e-26; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=1e-26; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=4e-10; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Chlamydomonas moewusii E-value=7e-10; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=1e-09; |
| Length | 400 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | ACTTCCTGGATTTACATTCAAAACATCTAAACTTAAAGAGGTATTTATACATTGAACCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825320 |
| Trichome-related Gene from Literature | N/A |