Detail of EST/Unigene GE349273 |
Acc. | GE349273 |
Internal Acc. | MEUA972TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Mus musculus E-value=8e-30; DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Homo sapiens E-value=8e-30; Probable DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Caenorhabditis briggsae E-value=1e-27; Probable DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Caenorhabditis elegans E-value=6e-27; DNA-directed RNA polymerases I, II, and III subunit rpabc3 OS=Dictyostelium discoideum E-value=5e-24; |
Length | 681 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AACTAAAATTTATTTACTAGAAACCAATCCACAAACTAGATAGTCATGCTGCAATCATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03016 DNA-directed RNA polymerase II subunit H |
EC | 2.7.7.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825129 |
Trichome-related Gene from Literature | N/A |