| Detail of EST/Unigene GE349273 |
| Acc. | GE349273 |
| Internal Acc. | MEUA972TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Mus musculus E-value=8e-30; DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Homo sapiens E-value=8e-30; Probable DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Caenorhabditis briggsae E-value=1e-27; Probable DNA-directed RNA polymerases I, II, and III subunit RPABC3 OS=Caenorhabditis elegans E-value=6e-27; DNA-directed RNA polymerases I, II, and III subunit rpabc3 OS=Dictyostelium discoideum E-value=5e-24; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | AACTAAAATTTATTTACTAGAAACCAATCCACAAACTAGATAGTCATGCTGCAATCATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03016 DNA-directed RNA polymerase II subunit H |
| EC | 2.7.7.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825129 |
| Trichome-related Gene from Literature | N/A |