Detail of EST/Unigene GE349437 |
Acc. | GE349437 |
Internal Acc. | MEUAB89TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L20, chloroplastic OS=Lotus japonicus E-value=5e-22; 50S ribosomal protein L20, chloroplastic OS=Glycine max E-value=3e-21; 50S ribosomal protein L20, chloroplastic OS=Phaseolus vulgaris E-value=2e-19; 50S ribosomal protein L20, chloroplastic OS=Morus indica E-value=9e-19; 50S ribosomal protein L20, chloroplastic OS=Buxus microphylla E-value=6e-18; |
Length | 444 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CGAAAAATACGACAATCCTATTGAGGATGTTGCGTTGTAAGAAAAAAGATAATAGGTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |