Detail of EST/Unigene GE349597 |
Acc. | GE349597 |
Internal Acc. | MEUAD84TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 3-1, chloroplastic OS=Arabidopsis thaliana E-value=6e-53; Thioredoxin-like 3-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-43; Thioredoxin-like 3-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-35; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=3e-10; Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=5e-10; |
Length | 658 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAAGATAGAGAGAAAATATTCATTGTGTTTTATAATGATTAACAATGTAGGTGGTGAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830305 |
Trichome-related Gene from Literature | N/A |