Detail of EST/Unigene GE349640 |
Acc. | GE349640 |
Internal Acc. | MEUAE50TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=1e-10; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=1e-10; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=1e-10; Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=3e-10; Small heat shock protein, chloroplastic OS=Pisum sativum E-value=9e-10; |
Length | 471 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AAAACACCAAGAAGCATGAAATCTTTATTCAAGAGAACTCAATTCCATTCAAACTTTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828881 |
Trichome-related Gene from Literature | N/A |