Detail of EST/Unigene GE350077 |
Acc. | GE350077 |
Internal Acc. | MEUAK26TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-64; Dihydrodipicolinate reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-64; Probable dihydrodipicolinate reductase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-57; Probable dihydrodipicolinate reductase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-57; |
Length | 605 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAAACTAAAATTGATACAAAAACACTCAGTTTTGGATGACTCACAATGGCACATAGTATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819009 |
Trichome-related Gene from Literature | N/A |