| Detail of EST/Unigene GE350077 |
| Acc. | GE350077 |
| Internal Acc. | MEUAK26TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-64; Dihydrodipicolinate reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-64; Probable dihydrodipicolinate reductase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-57; Probable dihydrodipicolinate reductase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-57; |
| Length | 605 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GAAACTAAAATTGATACAAAAACACTCAGTTTTGGATGACTCACAATGGCACATAGTATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819009 |
| Trichome-related Gene from Literature | N/A |