| Detail of EST/Unigene GE350214 |
| Acc. | GE350214 |
| Internal Acc. | MEUAL95TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-phosphate 3-epimerase, chloroplastic OS=Spinacia oleracea E-value=7e-58; Ribulose-phosphate 3-epimerase, chloroplastic (Fragment) OS=Solanum tuberosum E-value=6e-53; Ribulose-phosphate 3-epimerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-50; Ribulose-phosphate 3-epimerase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-38; Ribulose-phosphate 3-epimerase OS=Bacillus subtilis (strain 168) E-value=1e-26; |
| Length | 664 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GAAAAATTATAGCTGGTTTTCATTCAACCTTATATAATGTCAAAATCAAAAACTTGTTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K01783 ribulose-phosphate 3-epimerase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01783 ribulose-phosphate 3-epimerase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01783 ribulose-phosphate 3-epimerase |
| EC | 5.1.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836262 |
| Trichome-related Gene from Literature | N/A |