Detail of EST/Unigene GE350345 |
Acc. | GE350345 |
Internal Acc. | MEUAN67TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=1e-75; Caffeoyl-CoA O-methyltransferase 2 OS=Eucalyptus globulus E-value=2e-75; Caffeoyl-CoA O-methyltransferase 5 OS=Nicotiana tabacum E-value=3e-75; Caffeoyl-CoA O-methyltransferase OS=Petroselinum crispum E-value=9e-75; Caffeoyl-CoA O-methyltransferase OS=Zinnia elegans E-value=2e-74; |
Length | 702 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CGTCAAATACACATCGTCCTATATATTATTAATAAAAAAATATCAAAAGAAAAAAGTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
EC | 2.1.1.104 2.1.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829551 |
Trichome-related Gene from Literature | N/A |