| Detail of EST/Unigene GE350399 |
| Acc. | GE350399 |
| Internal Acc. | MEUAO32TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UPF0603 protein At1g54780, chloroplastic OS=Arabidopsis thaliana E-value=1e-08; UPF0603 protein Os05g0401100, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-08; UPF0603 protein OsI_019212, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-08; |
| Length | 98 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | CAACAAACCTCCAACTACAAGAAAGAATTGTCCACGCTTTTCTTCTGTCTCTTCCTTTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841919 |
| Trichome-related Gene from Literature | N/A |