Detail of EST/Unigene GE350670 |
Acc. | GE350670 |
Internal Acc. | MEUAR84TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 39S ribosomal protein L45, mitochondrial OS=Bos taurus E-value=5e-07; Probable 39S ribosomal protein L45, mitochondrial OS=Drosophila melanogaster E-value=9e-07; 39S ribosomal protein L45, mitochondrial OS=Xenopus laevis E-value=1e-05; 39S ribosomal protein L45, mitochondrial OS=Xenopus tropicalis E-value=2e-05; 39S ribosomal protein L45, mitochondrial OS=Homo sapiens E-value=2e-05; |
Length | 779 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAGGAAAATCTCTAAATTAATTTCATTCAAAAACAAAATTTGGATAGGTTTAAACCTATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.3.51 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 5008229 |
Trichome-related Gene from Literature | N/A |