| Detail of EST/Unigene GE350670 |
| Acc. | GE350670 |
| Internal Acc. | MEUAR84TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 39S ribosomal protein L45, mitochondrial OS=Bos taurus E-value=5e-07; Probable 39S ribosomal protein L45, mitochondrial OS=Drosophila melanogaster E-value=9e-07; 39S ribosomal protein L45, mitochondrial OS=Xenopus laevis E-value=1e-05; 39S ribosomal protein L45, mitochondrial OS=Xenopus tropicalis E-value=2e-05; 39S ribosomal protein L45, mitochondrial OS=Homo sapiens E-value=2e-05; |
| Length | 779 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | GAGGAAAATCTCTAAATTAATTTCATTCAAAAACAAAATTTGGATAGGTTTAAACCTATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.3.51 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 5008229 |
| Trichome-related Gene from Literature | N/A |