Detail of EST/Unigene GE350694 |
Acc. | GE350694 |
Internal Acc. | MEUAS19TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mannan endo-1,4-beta-mannosidase 6 OS=Arabidopsis thaliana E-value=7e-57; Putative mannan endo-1,4-beta-mannosidase 5 OS=Oryza sativa subsp. japonica E-value=2e-40; Mannan endo-1,4-beta-mannosidase 8 OS=Oryza sativa subsp. japonica E-value=4e-33; Mannan endo-1,4-beta-mannosidase 5 OS=Solanum lycopersicum E-value=1e-32; Mannan endo-1,4-beta-mannosidase 2 OS=Solanum lycopersicum E-value=1e-32; |
Length | 695 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CAATGACATTTTGCACTTTTATTTGATTATTACCGGCAAGTATGCATAACTGGTAAATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831699 |
Trichome-related Gene from Literature | N/A |