| Detail of EST/Unigene GE350705 |
| Acc. | GE350705 |
| Internal Acc. | MEUAS30TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=4e-66; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=2e-64; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=3e-64; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=3e-64; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=4e-64; |
| Length | 671 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | AAAAAGATGGGAAGCATGAAATGCAAATTTAACTATTAGAGTTGACAATAATAATTCATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
|
| Corresponding NCBI Gene | 824293 |
| Trichome-related Gene from Literature | N/A |