Detail of EST/Unigene GE350718 |
Acc. | GE350718 |
Internal Acc. | MEUAS46TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alanine aminotransferase 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-62; Alanine aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=2e-60; Alanine aminotransferase 2 OS=Panicum miliaceum E-value=2e-55; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=2e-55; Probable alanine aminotransferase, mitochondrial OS=Dictyostelium discoideum E-value=2e-39; |
Length | 710 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CAAGTCTTTCATATTCAACATGCAACTATAAGTTGAAAGTTGTAACAAAAAAATTATTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843565 |
Trichome-related Gene from Literature | N/A |