Detail of EST/Unigene GE350723 |
Acc. | GE350723 |
Internal Acc. | MEUAS55TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-33; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=9e-33; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-32; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-32; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-31; |
Length | 851 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | AGCAATTCAATGTATGATTTTCATTGAGACAAGAATGAAAGAAGCAATATAACATAGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |