Detail of EST/Unigene GE350742 |
Acc. | GE350742 |
Internal Acc. | MEUAS79TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Prunus persica E-value=6e-64; Superoxide dismutase [Mn], mitochondrial OS=Nicotiana plumbaginifolia E-value=2e-62; Superoxide dismutase [Mn], mitochondrial OS=Capsicum annuum E-value=5e-60; Superoxide dismutase [Mn], mitochondrial OS=Hevea brasiliensis E-value=9e-59; Superoxide dismutase [Mn] 3.1, mitochondrial OS=Zea mays E-value=1e-57; |
Length | 623 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GGAAGCAAAAAATAAAATCTTGTCTTGTCTTAATATAAAATCCATAAGGCACGAGGAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.15.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820263 |
Trichome-related Gene from Literature | N/A |