| Detail of EST/Unigene GE350822 |
| Acc. | GE350822 |
| Internal Acc. | MEUAT83TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=1e-31; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=2e-21; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-13; Photosystem II reaction center W protein, chloroplastic OS=Chlamydomonas reinhardtii E-value=6e-06; |
| Length | 581 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | CAAGCTGAAAATGTATTCAAATTGATTTAATACATCATGTGAGTAATCCATAACAAAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817606 |
| Trichome-related Gene from Literature | N/A |