Detail of EST/Unigene GE350919 |
Acc. | GE350919 |
Internal Acc. | MEUAV03TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=2e-94; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=1e-88; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=7e-87; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-86; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-83; |
Length | 770 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | CATTTATAACATAACTTCTTAAATTAAATAAAAGTCATGAATTATTGAAAAACACAAACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |