Detail of EST/Unigene GE351076 |
Acc. | GE351076 |
Internal Acc. | MEUAX09TR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=2e-59; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=3e-33; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=4e-32; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-27; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=3e-26; |
Length | 673 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2; |
Sequence | GAGTAACTACCTCAAGAATTGTATTTTAATCAAATATCAATCCCCCTACAAATAAATTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820440 |
Trichome-related Gene from Literature | N/A |