| Detail of EST/Unigene GE351125 |
| Acc. | GE351125 |
| Internal Acc. | MEUAX77TR |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cystathionine gamma-synthase OS=Helicobacter pylori E-value=9e-09; Cystathionine gamma-synthase OS=Helicobacter pylori (strain ATCC 700392 / 26695) E-value=2e-08; Cystathionine beta-lyase OS=Lactococcus lactis subsp. cremoris (strain MG1363) E-value=3e-08; Cystathionine beta-lyase OS=Lactococcus lactis subsp. lactis (strain IL1403) E-value=3e-08; Cystathionine gamma-synthase OS=Helicobacter pylori (strain J99) E-value=6e-08; |
| Length | 627 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2; |
| Sequence | TTAATTTCCTTCAATGTCCTTCATATCACACACAACATAAGTACTATAGTTTACACATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01758 cystathionine gamma-lyase |
| EC | 4.4.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842774 |
| Trichome-related Gene from Literature | N/A |